Read 2 Quality Worse Than Read 1 Sequencing

Introduction

During sequencing, the nucleotide bases in a DNA or RNA sample (library) are determined by the sequencer. For each fragment in the library, a sequence is generated, besides called a read, which is but a succession of nucleotides.

Modern sequencing technologies tin generate a massive number of sequence reads in a single experiment. Nevertheless, no sequencing technology is perfect, and each instrument will generate different types and amount of errors, such every bit incorrect nucleotides existence called. These wrongly chosen bases are due to the technical limitations of each sequencing platform.

Therefore, it is necessary to sympathise, place and exclude fault-types that may impact the interpretation of downstream assay. Sequence quality control is therefore an essential outset pace in your analysis. Communicable errors early saves fourth dimension later on on.

Agenda

In this tutorial, nosotros will deal with:

  1. Inspect a raw sequence file
  2. Assess quality with FASTQE 🧬😎 - short reads only
  3. Assess quality with FastQC - curt & long reads
    1. Per base sequence quality
    2. Per sequence quality scores
    3. Per base sequence content
    4. Per sequence GC content
    5. Sequence Duplication Levels
    6. Over-represented sequences
  4. Trim and filter - short reads
  5. Processing multiple datasets
    1. Process paired-cease data
  6. Assess quality with Nanoplot - Long reads only
    1. Histogram of read lengths
    2. Read lengths vs Average read quality plot using dots
  7. Appraise quality with PycoQC - Nanopore but
    1. Basecalled reads length
    2. Basecalled reads length vs reads PHRED quality
    3. Output over experiment time
    4. Channel action over time

Inspect a raw sequence file

hands_on Hands-on: Data upload

  1. Create a new history for this tutorial and give it a proper name

    Tip: Creating a new history

    Click the new-history icon at the superlative of the history panel.

    If the new-history is missing:

    1. Click on the galaxy-gear icon (History options) on the top of the history panel
    2. Select the selection Create New from the menu

    Tip: Renaming a history

    1. Click on Unnamed history (or the current name of the history) (Click to rename history) at the top of your history panel
    2. Type the new proper name
    3. Press Enter
  2. Import the file female_oral2.fastq-4143.gz from Zenodo or from the data library (ask your instructor) This is a microbiome sample from a serpent Jacques et al. 2021.

                      https://zenodo.org/record/3977236/files/female_oral2.fastq-4143.gz                                  
    • Copy the link location
    • Open up the Galaxy Upload Managing director ( galaxy-upload on the summit-right of the tool panel)

    • Select Paste/Fetch Information
    • Paste the link into the text field

    • Press Start

    • Close the window

    Tip: Importing data from a data library

    Every bit an alternative to uploading the information from a URL or your computer, the files may as well have been fabricated available from a shared data library:

    • Go into Shared information (top panel) then Data libraries
    • Navigate to the correct folder as indicated by your instructor
    • Select the desired files
    • Click on the To History push button near the top and select every bit Datasets from the dropdown carte
    • In the pop-up window, select the history y'all desire to import the files to (or create a new ane)
    • Click on Import
  3. Rename the imported dataset to Reads .

We just imported a file into Galaxy. This file is similar to the data we could get directly from a sequencing facility: a FASTQ file.

hands_on Hands-on: Audit the FASTQ file

  1. Inspect the file by clicking on the galaxy-centre (eye) icon

Although it looks complicated (and mayhap it is), the FASTQ format is like shooting fish in a barrel to understand with a niggling decoding.

Each read, representing a fragment of the library, is encoded by iv lines:

Line Description
1 Always begins with @ followed past the data about the read
2 The actual nucleic sequence
3 Always begins with a + and contains sometimes the same info in line ane
4 Has a string of characters which represent the quality scores associated with each base of the nucleic sequence; must have the same number of characters as line 2

And so for case, the commencement sequence in our file is:

            @M00970:337:000000000-BR5KF:1:1102:17745:1557 1:N:0:CGCAGAAC+ACAGAGTT GTGCCAGCCGCCGCGGTAGTCCGACGTGGCTGTCTCTTATACACATCTCCGAGCCCACGAGACCGAAGAACATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAAAAAAAAAAAAACAAAAAAAAAAAAAGAAGCAAATGACGATTCAAGAAAGAAAAAAACACAGAATACTAACAATAAGTCATAAACATCATCAACATAAAAAAGGAAATACACTTACAACACATATCAATATCTAAAATAAATGATCAGCACACAACATGACGATTACCACACATGTGTACTACAAGTCAACTA + GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGFGGGGGGAFFGGFGGGGGGGGFGGGGGGGGGGGGGGFGGG+38+35*311*vi,,31=******441+++0+0++0+*1*2++2++0*+*2*02*/***1*+++0+0++38++00++++++++++0+0+ii++*+*+*+*+*****+0**+0**+***+)*.***ane**//*)***)/)*)))*)))*),)0(((-((((-.(4(,,))).,(())))))).)))))))-))-(                      

It means that the fragment named @M00970 corresponds to the Dna sequence GTGCCAGCCGCCGCGGTAGTCCGACGTGGCTGTCTCTTATACACATCTCCGAGCCCACGAGACCGAAGAACATCTCGTATGCCGTCTTCTGCTTGAAAAAAAAAAAAAAAAAAAACAAAAAAAAAAAAAGAAGCAAATGACGATTCAAGAAAGAAAAAAACACAGAATACTAACAATAAGTCATAAACATCATCAACATAAAAAAGGAAATACACTTACAACACATATCAATATCTAAAATAAATGATCAGCACACAACATGACGATTACCACACATGTGTACTACAAGTCAACTA and this sequence has been sequenced with a quality GGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGGFGGGFGGGGGGAFFGGFGGGGGGGGFGGGGGGGGGGGGGGFGGG+38+35*311*half-dozen,,31=******441+++0+0++0+*i*2++2++0*+*2*02*/***ane*+++0+0++38++00++++++++++0+0+two++*+*+*+*+*****+0**+0**+***+)*.***1**//*)***)/)*)))*)))*),)0(((-((((-.(four(,,))).,(())))))).)))))))-))-(.

But what does this quality score mean?

The quality score for each sequence is a string of characters, i for each base of operations of the nucleic sequence, used to characterize the probability of mis-identification of each base. The score is encoded using the ASCII character table (with some historical differences):

Encoding of the quality score with ASCII characters for different Phred encoding. The ascii code sequence is shown at the top with symbols for 33 to 64, upper case letters, more symbols, and then lowercase letters. Sanger maps from 33 to 73 while solexa is shifted, starting at 59 and going to 104. Illumina 1.3 starts at 54 and goes to 104, Illumina 1.5 is shifted three scores to the right but still ends at 104. Illumina 1.8+ goes back to the Sanger except one single score wider. Illumina.

So there is an ASCII character associated with each nucleotide, representing its Phred quality score, the probability of an incorrect base of operations call:

Phred Quality Score Probability of incorrect base call Base of operations call accurateness
10 1 in 10 90%
20 1 in 100 99%
xxx 1 in one thousand 99.ix%
twoscore i in 10,000 99.99%
50 ane in 100,000 99.999%
60 1 in 1,000,000 99.9999%

question Questions

  1. Which ASCII character corresponds to the worst Phred score for Illumina 1.8+?
  2. What is the Phred quality score of the 3rd nucleotide of the 1st sequence?
  3. What is the accuracy of this 3rd nucleotide?

solution Solution

  1. The worst Phred score is the smallest one, and then 0. For Illumina 1.8+, it corresponds to the ! grapheme.
  2. The 3rd nucleotide of the 1st sequence has a ASCII grapheme G, which correspond to a score of 38.
  3. The corresponding nucleotide Thousand has an accurateness of almost 99.99%

When looking at the file in Milky way, it looks similar near the nucleotides have a high score (G corresponding to a score 38). Is it true for all sequences? And along the full sequence length?

Assess quality with FASTQE 🧬😎 - short reads only

To accept a expect at sequence quality along all sequences, nosotros tin use FASTQE. It is an open-source tool that provides a simple and fun way to quality command raw sequence data and print them as emoji. You can utilize it to give a quick impression of whether your data has any problems of which y'all should exist aware before doing any farther analysis.

hands_on Hands-on: Quality check

  1. FASTQE Tool: toolshed.g2.bx.psu.edu/repos/iuc/fastqe/fastqe/0.2.six+galaxytwo with the following parameters
    • param-files "FastQ data": Reads
    • param-select "Score types to show": Mean
  2. Inspect the generated HTML file

Rather than looking at quality scores for each individual read, FASTQE looks at quality collectively across all reads within a sample and can calculate the mean for each nucleotide position along the length of the reads. Below shows the hateful values for this dataset.

FASTQE before.
Figure one: FASTQE hateful scores

You can see the score for each emoji here. The emojis below, with Phred scores less than 20, are the ones we hope nosotros don't see much.

Phred Quality Score ASCII code Emoji
0 ! 🚫
i " ❌
2 # 👺
3 $ 💔
4 % 🙅
5 & 👾
six ' 👿
7 ( 💀
8 ) 👻
nine * 🙈
10 + 🙉
eleven , 🙊
12 - 🐵
xiii . 😿
xiv / 😾
15 0 🙀
16 1 💣
17 2 🔥
18 3 😡
xix 4 💩

question Questions

What is the lowest mean score in this dataset?

solution Solution

The lowest score in this dataset is 😿 13.

Appraise quality with FastQC - brusque & long reads

An additional or alternative way nosotros can check sequence quality is with FastQC. Information technology provides a modular ready of analyses which you can use to check whether your data has any issues of which yous should be aware before doing whatsoever further analysis. We can apply information technology, for example, to appraise whether there are known adapters nowadays in the data. We'll run information technology on the FASTQ file.

hands_on Easily-on: Quality check

  1. FASTQC Tool: toolshed.g2.bx.psu.edu/repos/devteam/fastqc/fastqc/0.73+galaxy0 with the post-obit parameters
    • param-files "Raw read information from your electric current history": Reads
  2. Inspect the generated HTML file

question Questions

Which Phred encoding is used in the FASTQ file for these sequences?

solution Solution

The Phred scores are encoded using Sanger / Illumina 1.9 (Encoding in the top tabular array).

Per base sequence quality

With FastQC nosotros tin can use the per base of operations sequence quality plot to check the base of operations quality of the reads, similar to what we did with FASTQE.

Per base sequence quality.
Figure two: Per base of operations sequence quality

On the ten-centrality are the base position in the read. In this example, the sample contains reads that are up to 296 bp long.

details Non uniform x-centrality

The x-axis is not always compatible. When you have long reads, some binning is applied to keep things compact. Nosotros can see that in our sample. Information technology starts out with individual i-10 bases. Afterward that, bases are binned beyond a window a sure number of bases wide. Information binning means grouping and is a data pre-processing technique used to reduce the effects of minor ascertainment errors. The number of base positions binned together depends on the length of the read. With reads >50bp, the latter part of the plot will written report aggregate statistics for 5bp windows. Shorter reads will accept smaller windows and longer reads larger windows. Binning can be removed when running FastQC by setting the paramter "Disable grouping of bases for reads >50bp" to Yes.

For each position, a boxplot is fatigued with:

  • the median value, represented by the fundamental red line
  • the inter-quartile range (25-75%), represented by the xanthous box
  • the 10% and 90% values in the upper and lower whiskers
  • the hateful quality, represented by the bluish line

The y-centrality shows the quality scores. The college the score, the meliorate the base of operations call. The groundwork of the graph divides the y-centrality into very proficient quality scores (light-green), scores of reasonable quality (orange), and reads of poor quality (red).

It is normal with all Illumina sequencers for the median quality score to beginning out lower over the outset 5-7 bases and to so rise. The quality of reads on most platforms will drop at the end of the read. This is often due to betoken disuse or phasing during the sequencing run. The recent developments in chemistry applied to sequencing has improved this somewhat, just reads are now longer than e'er.

details Betoken decay and phasing

  • Point decay

The fluorescent signal intensity decays with each cycle of the sequencing procedure. Due to the degrading fluorophores, a proportion of the strands in the cluster are not beingness elongated. The proportion of the betoken being emitted continues to decrease with each cycle, yielding to a decrease of quality scores at the 3' finish of the read.

  • Phasing

The bespeak starts to blur with the increase of number of cycles because the cluster looses synchronicity. Every bit the cycles progress, some strands get random failures of nucleotides to comprise due to:

  • Incomplete removal of the 3' terminators and fluorophores
  • Incorporation of nucleotides without constructive 3' terminators

This leads to a decrease in quality scores at the 3' terminate of the read.

details Other sequence quality profiles

These are some per base of operations sequence quality profiles that can indicate issues with the sequencing.

  • Overclustering

    Sequencing facilities can overcluster the catamenia cells. Information technology results in small-scale distances betwixt clusters and an overlap in the signals. Two clusters can be interpreted equally a single cluster with mixed fluorescent signals beingness detected, decreasing signal purity. Information technology generates lower quality scores beyond the entire read.

  • Instrumentation breakdown

    Some issues tin occasionally happen with the sequencing instruments during a run. Any sudden drop in quality or a large percentage of low quality reads across the read could indicate a problem at the facility. Some examples of such issues:

    • Manifold flare-up

      Manifold burst.

    • Cycles loss

      Cycles loss.

    • Read 2 failure

      Cycles loss.

    With such information, the sequencing facility should exist contacted for word. Often, a resequencing then is needed (and from our feel too offered by the company).

question Questions

  1. How does the hateful quality score change along the sequence?
  2. Is this tendency seen in all sequences?

solution Solution

  1. The mean quality score (blueish line) drops well-nigh midway though these sequences. It is common for the hateful quality to drop towards the end of the sequences, as the sequencers are incorporating more wrong nucleotides at the cease. However, in this sample there is a very large drop in quality from the centre onwards.
  2. The box plots are getting wider from position ~100. Information technology means a lot of sequences have their score dropping from the eye of the sequence. Afterward 100 nucleotides, more than than 10% of the sequences have scores below twenty.

When the median quality is beneath a Phred score of ~20, we should consider trimming away bad quality bases from the sequence. Nosotros will explain that process in the Trim and filter department.

Adapter Content

Adapter Content.
Effigy 3: Adapter Content

The plot shows the cumulative pct of reads with the different adapter sequences at each position. One time an adapter sequence is seen in a read it is counted equally being present right through to the stop of the read then the percentage increases with the read length. FastQC can detect some adapters by default (eastward.thousand. Illumina, Nextera), for others nosotros could provide a contaminants file every bit an input to the FastQC tool.

Ideally Illumina sequence data should not have any adapter sequence present. But with long reads, some of the library inserts are shorter than the read length resulting in read-through to the adapter at the 3' end of the read. This microbiome sample has relatively long reads and we can see Nextera dapater has been detected.

details Other adapter content profiles

Adapter content may also exist detected with RNA-Seq libraries where the distribution of library insert sizes is varied and likely to include some short inserts.

Adapter Content.

We tin run an trimming tool such as Cutadapt to remove this adapter. We volition explain that process in the filter and trim section.

Per tile sequence quality

This plot enables you to wait at the quality scores from each tile across all of your bases to see if there was a loss in quality associated with only one part of the flowcell. The plot shows the deviation from the boilerplate quality for each flowcell tile. The hotter colours signal that reads in the given tile take worse qualities for that position than reads in other tiles. With this sample, you can see that certain tiles bear witness consistently poor quality, particularly from ~100bp onwards. A good plot should be blue all over.

Per tile sequence quality.
Figure iv: Per tile sequence quality

This plot will only appear for Illumina library which retains its original sequence identifiers. Encoded in these is the flowcell tile from which each read came.

details Other tile quality profiles

In some cases, the chemicals used during sequencing becoming a bit exhausted over the time and the last tiles got worst chemicals which makes the sequencing reactions a bit error-prone. The "Per tile sequence quality" graph will and so take some horizontal lines like this:

Per tile sequence quality with horizontal lines.

Per sequence quality scores

It plots the average quality score over the full length of all reads on the x-axis and gives the total number of reads with this score on the y-axis:

Per sequence quality scores.
Figure v: Per sequence quality scores

The distribution of average read quality should be tight acme in the upper range of the plot. It can also report if a subset of the sequences have universally low quality values: it can happen because some sequences are poorly imaged (on the border of the field of view etc), however these should represent only a minor percentage of the total sequences.

Per base sequence content

Per base sequence content.
Figure vi: Per base of operations sequence content for a Dna library

"Per Base Sequence Content" plots the percentage of each of the four nucleotides (T, C, A, G) at each position across all reads in the input sequence file. Equally for the per base sequence quality, the x-axis is non-compatible.

In a random library we would look that there would be petty to no difference between the 4 bases. The proportion of each of the four bases should remain relatively constant over the length of the read with %A=%T and %Grand=%C, and the lines in this plot should run parallel with each other. This is amplicon information, where 16S DNA is PCR amplified and sequenced, so we'd expect this plot to have some bias and not show a random distribution.

details Biases past library type

It's worth noting that some library types will always produce biased sequence composition, normally at the beginning of the read. Libraries produced past priming using random hexamers (including well-nigh all RNA-Seq libraries), and those which were fragmented using transposases, volition contain an intrinsic bias in the positions at which reads get-go (the first x-12 bases). This bias does not involve a specific sequence, but instead provides enrichment of a number of different K-mers at the v' end of the reads. Whilst this is a truthful technical bias, it isn't something which tin can be corrected by trimming and in near cases doesn't seem to adversely affect the downstream analysis. It will, however, produce a warning or fault in this module.

Per base sequence content for RNA-seq data.

ChIP-seq data can also encounter read commencement sequence biases in this plot if fragmenting with transposases. With bisulphite converted data, e.g. HiC data, a separation of Thousand from C and A from T is expected:

Per base sequence content for Bisulphite data.

At the end, there is an overall shift in the sequence limerick. If the shift correlates with a loss of sequencing quality, it can be suspected that miscalls are made with a more even sequence bias than bisulphite converted libraries. Trimming the sequences fixed this problem, but if this hadn't been done it would have had a dramatic issue on the methylation calls which were fabricated.

question Questions

Why is there a warning for the per-base of operations sequence content graphs?

solution Solution

In the commencement of sequences, the sequence content per base of operations is non really proficient and the percentages are not equal, as expected for 16S amplicon information.

Per sequence GC content

Per sequence GC content.
Figure seven: Per sequence GC content

This plot displays the number of reads vs. pct of bases G and C per read. It is compared to a theoretical distribution assuming an uniform GC content for all reads, expected for whole genome shotgun sequencing, where the central peak corresponds to the overall GC content of the underlying genome. Since the GC content of the genome is not known, the modal GC content is calculated from the observed data and used to build a reference distribution.

An unusually-shaped distribution could indicate a contaminated library or some other kind of biased subset. A shifted normal distribution indicates some systematic bias, which is independent of base position. If there is a systematic bias which creates a shifted normal distribution then this won't be flagged as an error by the module since it doesn't know what your genome'due south GC content should be.

But in that location are besides other situations in which an unusually-shaped distribution may occur. For example, with RNA sequencing there may be a greater or lesser distribution of mean GC content amongst transcripts causing the observed plot to be wider or narrower than an ideal normal distribution.

question Questions

Why is there a fail for the per sequence GC content graphs?

solution Solution

There are multiple peaks. This tin be indicative of unexpected contagion, such as adapter, rRNA or overrepresented sequences. Or information technology may be normal if it is amplicon information or you have highly abundant RNA-seq transcripts.

Sequence length distribution

This plot shows the distribution of fragment sizes in the file which was analysed. In many cases this will produce a simple plot showing a peak but at i size, just for variable length FASTQ files this will testify the relative amounts of each different size of sequence fragment. Our plot shows variable length as we trimmed the data. The biggest peak is at 296bp only in that location is a second big top at ~100bp. And so even though our sequences range up to 296bp in length, a lot of the skillful-quality sequences are shorter. This corresponds with the drop nosotros saw in the sequence quality at ~100bp and the cerise stripes starting at this position in the per tile sequence quality plot.

Sequence length distribution.
Figure 8: Sequence length distribution

Some loftier-throughput sequencers generate sequence fragments of compatible length, but others can contain reads of widely varying lengths. Even within uniform length libraries some pipelines will trim sequences to remove poor quality base calls from the end or the first \(n\) bases if they lucifer the kickoff \(n\) bases of the adapter upward to ninety% (by default), with sometimes \(n = 1\).

Sequence Duplication Levels

The graph shows in bluish the percentage of reads of a given sequence in the file which are nowadays a given number of times in the file:

Sequence Duplication Levels.
Figure 9: Sequence Duplication Levels

In a various library virtually sequences will occur only once in the last ready. A low level of duplication may indicate a very high level of coverage of the target sequence, simply a high level of duplication is more probable to indicate some kind of enrichment bias.

Two sources of indistinguishable reads tin be constitute:

  • PCR duplication in which library fragments accept been over-represented due to biased PCR enrichment

    It is a business organization because PCR duplicates misrepresent the true proportion of sequences in the input.

  • Truly over-represented sequences such as very arable transcripts in an RNA-Seq library or in amplicon data (like this sample)

    Information technology is an expected case and not of business concern because it does faithfully represent the input.

details More than details about duplication

FastQC counts the degree of duplication for every sequence in a library and creates a plot showing the relative number of sequences with unlike degrees of duplication. In that location are ii lines on the plot:

  • Blue line: distribution of the duplication levels for the full sequence set
  • Blood-red line: distribution for the de-duplicated sequences with the proportions of the deduplicated set which come from unlike duplication levels in the original data.

For whole genome shotgun information information technology is expected that nearly 100% of your reads will be unique (appearing only 1 time in the sequence data). Almost sequences should autumn into the far left of the plot in both the ruby-red and blueish lines. This indicates a highly diverse library that was not over sequenced. If the sequencing depth is extremely high (e.k. > 100x the size of the genome) some inevitable sequence duplication tin appear: in that location are in theory simply a finite number of completely unique sequence reads which can exist obtained from any given input DNA sample.

More specific enrichments of subsets, or the presence of depression complexity contaminants will tend to produce spikes towards the right of the plot. These high duplication peaks will most often appear in the blue trace as they make up a high proportion of the original library, but usually disappear in the red trace as they make upwards an insignificant proportion of the deduplicated gear up. If peaks persist in the cherry-red trace and so this suggests that there are a big number of different highly duplicated sequences which might indicate either a contaminant set or a very astringent technical duplication.

It is ordinarily the instance for RNA sequencing where there is some very highly abundant transcripts and some lowly abundant. It is expected that indistinguishable reads will be observed for high abundance transcripts:

Sequence Duplication Levels for RNA-seq.

Over-represented sequences

A normal high-throughput library will contain a various set of sequences, with no individual sequence making upwards a tiny fraction of the whole. Finding that a unmarried sequence is very over-represented in the set either means that it is highly biologically meaning, or indicates that the library is contaminated, or non every bit diverse as expected.

FastQC lists all of the sequence which make upward more than 0.1% of the total. For each over-represented sequence FastQC will look for matches in a database of common contaminants and volition written report the best striking it finds. Hits must be at least 20bp in length and accept no more than one mismatch. Finding a hit doesn't necessarily hateful that this is the source of the contamination, but may point y'all in the right direction. Information technology'due south as well worth pointing out that many adapter sequences are very similar to each other so you may go a hit reported which isn't technically right, simply which has a very similar sequence to the actual match.

RNA sequencing data may have some transcripts that are and so abundant that they annals as over-represented sequence. With Dna sequencing data no single sequence should be present at a loftier enough frequency to be listed, but we can sometimes see a small percentage of adapter reads.

question Questions

How could we find out what the overrepreseented sequences are?

solution Solution

We tin can Smash overrepresented sequences to run into what they are. In this case, if we accept the top overrepresented sequence

                >overrep_seq1 GTGTCAGCCGCCGCGGTAGTCCGACGTGGCTGTCTCTTATACACATCTCC                              

and use blastn against the default Nucleotide (nr/nt) database we don't get whatever hits. But if nosotros utilize VecScreen nosotros encounter it is the Nextera adapter.

VecScreen.
Figure x: Nextera adapter

details More than details about other FastQC plots

Per base of operations N content

Per base N content.
Figure eleven: Per base North content

If a sequencer is unable to brand a base call with sufficient confidence, it will write an "N" instead of a conventional base call. This plot displays the pct of base calls at each position or bin for which an N was chosen.

It'south not unusual to see a very high proportion of Ns appearing in a sequence, especially near the end of a sequence. Only this curve should never rises noticeably above zero. If it does this indicates a problem occurred during the sequencing run. In the example below, an fault acquired the instrument to exist unable to call a base for approximately 20% of the reads at position 29:

Per base N content.

Kmer Content

This plot not output past default. As stated in the tool class, if y'all want this module information technology needs to be enabled using a custom Submodule and limits file. With this module, FastQC does a generic assay of all of the short nucleotide sequences of length k (kmer, with k = 7 past default) starting at each position along the read in the library to observe those which exercise not have an even coverage through the length of your reads. Any given kmer should be evenly represented beyond the length of the read.

FastQC will report the list of kmers which appear at specific positions with a greater frequency than expected. This can exist due to different sources of bias in the library, including the presence of read-through adapter sequences edifice up on the end of the sequences. The presence of any overrepresented sequences in the library (such every bit adapter dimers) causes the kmer plot to be dominated past the kmer from these sequences. Any biased kmer due to other interesting biases may be then diluted and not easy to run across.

The post-obit example is from a high-quality DNA-Seq library. The biased kmers nearby the commencement of the read likely are due to slight sequence dependent efficiency of DNA shearing or a result of random priming:

Kmer Content.
Figure 12: Kmer content

This module can be very hard to interpret. The adapter content plot and overrepesented sequences table are easier to interpret and may give you enough information without needing this plot. RNA-seq libraries may take highly represented kmers that are derived from highly expressed sequences. To learn more than nearly this plot, please check the FastQC Kmer Content documentation.

We tried to explain here there different FastQC reports and some apply cases. More virtually this and besides some mutual adjacent-generation sequencing problems can be found on QCFAIL.com

details Specific problem for alternate library types

Small/micro RNA

In small RNA libraries, we typically have a relatively small gear up of unique, curt sequences. Small RNA libraries are not randomly sheared before adding sequencing adapters to their ends: all the reads for specific classes of microRNAsouthward volition be identical. Information technology will result in:

  • Extremely biased per base of operations sequence content
  • Extremely narrow distribution of GC content
  • Very high sequence duplication levels
  • Abundance of overrepresented sequences
  • Read-through into adapters

Amplicon

Amplicon libraries are prepared by PCR amplification of a specific target. For case, the V4 hypervariable region of the bacterial 16S rRNA gene. All reads from this type of library are expected to be almost identical. It volition effect in:

  • Extremely biased per base of operations sequence content
  • Extremely narrow distribution of GC content
  • Very high sequence duplication levels
  • Abundance of overrepresented sequences

Bisulfite or Methylation sequencing

With Bisulfite or methylation sequencing, the majority of the cytosine (C) bases are converted to thymine (T). It will result in:

  • Biased per base sequence content
  • Biased per sequence GC content

Adapter dimer contagion

Whatsoever library blazon may comprise a very small percentage of adapter dimer (i.e. no insert) fragments. They are more probable to be found in amplicon libraries constructed entirely by PCR (by formation of PCR primer-dimers) than in Deoxyribonucleic acid-Seq or RNA-Seq libraries synthetic by adapter ligation. If a sufficient fraction of the library is adapter dimer information technology volition become noticeable in the FastQC report:

  • Driblet in per base of operations sequence quality subsequently base of operations 60
  • Possible bi-modal distribution of per sequence quality scores
  • Distinct pattern observed in per bases sequence content up to base of operations 60
  • Spike in per sequence GC content
  • Overrepresented sequence matching adapter
  • Adapter content > 0% starting at base ane

Trim and filter - brusk reads

The quality drops in the middle of these sequences. This could crusade bias in downstream analyses with these potentially incorrectly called nucleotides. Sequences must exist treated to reduce bias in downstream assay. Trimming can help to increase the number of reads the aligner or assembler are able to succesfully utilize, reducing the number of reads that are unmapped or unassembled. In general, quality treatments include:

  1. Trimming/cutting/masking sequences
    • from low quality score regions
    • beginning/end of sequence
    • removing adapters
  2. Filtering of sequences
    • with low mean quality score
    • likewise brusque
    • with too many ambiguous (N) bases

To achieve this task we volition use Cutadapt Marcel 2011, a tool that enhances sequence quality by automating adapter trimming too every bit quality control. Nosotros will:

  • Trim low-quality bases from the ends. Quality trimming is done earlier whatever adapter trimming. We volition set the quality threshold as xx, a commonly used threshold, see more here.
  • Trim adapter with Cutadapt. For that we need to supply the sequence of the adapter. In this sample, Nextera is the adapter that was detected. We can find the sequence of the Nextera adapter on the Illumina website hither CTGTCTCTTATACACATCT. We volition trim that sequence from the 3' end of the reads.
  • Filter out sequences with length < 20 afterwards trimming

hands_on Hands-on: Improvement of sequence quality

  1. Cutadapt Tool: toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/3.iv+galaxy2 with the post-obit parameters
    • "Unmarried-end or Paired-end reads?": Single-end
      • param-file "Reads in FASTQ format": Reads (Input dataset)

        tip Tip: Files not selectable?

        If your FASTQ file cannot exist selected, you lot might check whether the format is FASTQ with Sanger-scaled quality values (fastqsanger.gz). You tin can edit the data type by clicking on the pencil symbol.

    • In "Read 1 Options":
      • "Insert 3' (Stop) Adapters":
        • "Source": Enter custom sequence
        • "Enter custom 3' adapter sequence": CTGTCTCTTATACACATCT
    • In "Filter Options"
      • "Minimum length": xx
    • In "Read Modification Options"
      • "Quality cutoff": 20
    • param-select "Outputs selector": Report
  2. Inspect the generated txt file (Report)

    question Questions

    1. What % reads incorporate adapter?
    2. What % reads take been trimmed considering of bad quality?
    3. What % reads have been removed considering they were too brusk?

    solution Solution

    1. 58.6% reads incorporate adapter ( Reads with adapters:)
    2. 35.1% reads take been trimmed because of bad quality (Quality-trimmed:)
    3. 0 % reads were removed considering they were too brusque

details Trimming with Cutadapt

One of the biggest reward of Cutadapt compared to other trimming tools (e.g. TrimGalore!) is that it has a good documentation explaining how the tool works in item.

Cutadapt quality trimming algorithm consists of 3 simple steps:

  1. Decrease the chosen threshold value from the quality value of each position
  2. Compute a fractional sum of these differences from the finish of the sequence to each position (every bit long equally the fractional sum is negative)
  3. Cut at the minimum value of the fractional sum

In the post-obit example, we presume that the iii' stop is to be quality-trimmed with a threshold of ten and we have the post-obit quality values

  1. Subtract the threshold

                                          32 thirty 16 17 -2 -3 one -6 -8 -seven                                  
  2. Add up the numbers, starting from the 3' terminate (fractional sums) and stop early if the sum is greater than zero

                                          (seventy) (38) 8 -8 -25 -23 -20, -21 -15 -seven                                  

    The numbers in parentheses are not computed (because 8 is greater than cipher), just shown hither for completeness.

  3. Choose the position of the minimum (-25) as the trimming position

Therefore, the read is trimmed to the outset four bases, which have quality values

Note that therefore, positions with a quality value larger than the chosen threshold are as well removed if they are embedded in regions with lower quality (the partial sum is decreasing if the quality values are smaller than the threshold). The advantage of this procedure is that it is robust against a small number of positions with a quality higher than the threshold.

Alternatives to this procedure would exist:

  • Cutting afterward the first position with a quality smaller than the threshold
  • Sliding window arroyo

    The sliding window approach checks that the average quality of each sequence window of specified length is larger than the threshold. Note that in contrast to cutadapt's approach, this approach has ane more parameter and the robustness depends of the length of the window (in combination with the quality threshold). Both approaches are implemented in Trimmomatic.

Nosotros tin can examine our trimmed information with FASTQE and/or FastQC.

hands_on Hands-on: Checking quality after trimming

  1. FASTQE Tool: toolshed.g2.bx.psu.edu/repos/iuc/fastqe/fastqe/0.2.6+galaxy2 : Re-run FASTQE with the post-obit parameters
    • param-files "FastQ data": Cutadapt Read one Output
    • param-select "Score types to testify": Mean
  2. Inspect the new FASTQE written report

    question Questions

    Compare the FASTQE output to the previous one earlier trimming above. Has sequence quality been improved?

    Tip: Using the Scratchbook to view multiple datasets

    If you would like to view 2 or more than datasets at once, you can utilize the Scratchbook feature in Galaxy:

    1. Click on the Scratchbook icon galaxy-scratchbook on the top menu bar.
      • You lot should see a little checkmark on the icon now
    2. View milky way-center a dataset by clicking on the eye icon galaxy-center to view the output
      • You should see the output in a window overlayed over Milky way
      • You tin resize this window by dragging the lesser-right corner
    3. Click outside the file to exit the Scratchbook
    4. View galaxy-eye a second dataset from your history
      • Yous should now see a second window with the new dataset
      • This makes it easier to compare the two outputs
    5. Echo this for as many files as you would like to compare
    6. You tin can turn off the Scratchbook galaxy-scratchbook by clicking on the icon once more

    solution Solution

    Yes, the quality score emojis await meliorate (happier) now.

    FASTQE before.
    Effigy 13: Before trimming
    FASTQE after.
    Figure fourteen: After trimming

With FASTQE nosotros tin can run into we improved the quality of the bases in the dataset.

Nosotros tin can also, or instead, check the quality-controlled data with FastQC.

hands_on Easily-on: Checking quality afterwards trimming

  1. FASTQC Tool: toolshed.g2.bx.psu.edu/repos/devteam/fastqc/fastqc/0.73+galaxy0 with the following parameters
    • param-files "Curt read data from your electric current history": Cutadapt Read ane Output
  2. Audit the generated HTML file

question Questions

  1. Does the per base sequence quality look ameliorate?
  2. Is the adapter gone?

solution Solution

  1. Yes. The vast bulk of the bases take a quality score higher up 20 now.
Per base sequence quality.
Figure 15: Per base sequence quality
  1. Yes. No adapter is detected now. Adapter Content.

With FastQC nosotros can see we improved the quality of the bases in the dataset and removed the adapter.

details Other FastQC plots after trimming

Per tile sequence quality. We have some red stripes every bit we've trimmed those regions from the reads.

Per sequence quality scores. We now have one tiptop of high quality instead of i high and one lower quality that we had previously.

Per base sequence content. Nosotros don't have equal representation of the bases as before equally this is amplicon data.

Per sequence GC content. We now have a single main GC peak due to removing the adapter.

Per base N content. This is the same as before as we don't accept whatever Ns in these reads.

Sequence length distribution. We at present have multiple peaks and a range of lengths, instead of the unmarried meridian with had before trimming when all sequences were the same length.

Sequence Duplication Levels.

question Questions

What does the height overrepresented sequence GTGTCAGCCGCCGCGGTAGTCCGACGTGG correspond to?

solution Solution

If we take the top overrepresented sequence

                  >overrep_seq1_after GTGTCAGCCGCCGCGGTAGTCCGACGTGG                                  

and use blastn confronting the default Nucleotide (nr/nt) database we see the top hits are to 16S rRNA genes. This makes sense as this is 16S amplicon data, where the 16S gene is PCR amplified.

Processing multiple datasets

Process paired-cease data

With paired-end sequencing, the fragments are sequenced from both sides. This approach results in two reads per fragment, with the start read in forward orientation and the 2nd read in reverse-complement orientation. With this technique, nosotros have the advantage to go more information well-nigh each DNA fragment compared to reads sequenced by merely single-end sequencing:

                          ------>                       [single-end]      ----------------------------- [fragment]      ------>               <------ [paired-stop]                      

The distance between both reads is known and therefore is additional information that can improve read mapping.

Paired-end sequencing generates 2 FASTQ files:

  • One file with the sequences respective to frontward orientation of all the fragments
  • One file with the sequences corresponding to contrary orientation of all the fragments

Usually nosotros recognize these two files which belong to 1 sample by the proper noun which has the same identifier for the reads only a unlike extension, e.g. sampleA_R1.fastq for the forrard reads and sampleA_R2.fastq for the reverse reads. It tin as well be _f or _1 for the frontward reads and _r or _2 for the reverse reads.

The data we analyzed in the previous step was single-end data and so we volition import a paired-end RNA-seq dataset to use. We will run FastQC and amass the ii reports with MultiQC Ewels et al. 2016.

hands_on Hands-on: Assessing the quality of paired-cease reads

  1. Import the paired-end reads GSM461178_untreat_paired_subset_1.fastq and GSM461178_untreat_paired_subset_2.fastq from Zenodo or from the data library (ask your instructor)

                      https://zenodo.org/record/61771/files/GSM461178_untreat_paired_subset_1.fastq https://zenodo.org/record/61771/files/GSM461178_untreat_paired_subset_2.fastq                                  
  2. FASTQC Tool: toolshed.g2.bx.psu.edu/repos/devteam/fastqc/fastqc/0.73+galaxy0 with both datasets:
    • param-files "Raw read data from your electric current history": both the uploaded datasets.

    Tip: Select multiple datasets

    1. Click on param-files Multiple datasets
    2. Select several files past keeping the Ctrl (orCOMMAND) key pressed and clicking on the files of interest
  3. MultiQC Tool: toolshed.g2.bx.psu.edu/repos/iuc/multiqc/multiqc/1.9+milky wayone with the following parameters to amass the FastQC reports of both forward and contrary reads
    • In "Results"
      • "Which tool was used generate logs?": FastQC
      • In "FastQC output"
        • "Type of FastQC output?": Raw data
        • param-files "FastQC output": Raw data files (output of both FastQC tool)
  4. Inspect the webpage output from MultiQC.

question Questions

  1. What do you retrieve about the quality of the sequences?
  2. What should nosotros exercise?

solution Solution

  1. The quality of the sequences seems worse for the reverse reads than for the forwards reads:
    • Per Sequence Quality Scores: distribution more on the left, i.due east. a lower mean quality of the sequences
    • Per base sequence quality: less smoothen curve and stronger decrease at the terminate with a mean value beneath 28
    • Per Base Sequence Content: stronger bias at the beginning and no clear stardom between C-G and A-T groups

    The other indicators (adapters, duplication levels, etc) are similar.

  2. We should trim the end of the sequences and filter them with Cutadapt tool

With paired-terminate reads the boilerplate quality scores for forwards reads will almost ever be higher than for opposite reads.

Subsequently trimming, opposite reads will exist shorter because of their quality and so will exist eliminated during the filtering pace. If ane of the reverse reads is removed, its corresponding frontwards read should exist removed too. Otherwise nosotros will get different number of reads in both files and in different order, and guild is important for the side by side steps. Therefore it is important to treat the frontwards and opposite reads together for trimming and filtering.

hands_on Hands-on: Improving the quality of paired-stop information

  1. Cutadapt Tool: toolshed.g2.bx.psu.edu/repos/lparsons/cutadapt/cutadapt/3.iv+galaxy2 with the following parameters
    • "Single-end or Paired-finish reads?": Paired-end
      • param-file "FASTQ/A file #1": GSM461178_untreat_paired_subset_1.fastq (Input dataset)
      • param-file "FASTQ/A file #2": GSM461178_untreat_paired_subset_2.fastq (Input dataset)

        The order is of import here!

      • In Read 1 Options or Read 2 Options

        No adapters were found in these datasets. When you process your own data and y'all know which adapter sequences were used during library preparation, y'all should provide their sequences here.

    • In "Filter Options"
      • "Minimum length": 20
    • In "Read Modification Options"
      • "Quality cutoff": 20
    • In "Output Options"
      • "Report": Yes
  2. Inspect the generated txt file (Report)

    question Questions

    1. How many basepairs has been removed from the reads because of bad quality?
    2. How many sequence pairs have been removed because they were as well brusk?

    solution Solution

    1. 44,164 bp (Quality-trimmed:) for the frontwards reads and 138,638 bp for the reverse reads.
    2. 1,376 sequences accept been removed considering at least ane read was shorter than the length cutoff (322 when only the forward reads were analyzed).

In improver to the report, Cutadapt generates two files:

  • Read 1 with the trimmed and filtered forwards reads
  • Read 2 with the trimmed and filtered reverse reads

These datasets can be used for the downstream analysis, e.g. mapping.

question Questions

  1. What kind of alignment is used for finding adapters in reads?
  2. What is the criterion to choose the all-time adapter alignment?

solution Solution

  1. Semi-global alignment, i.due east., but the overlapping part of the read and the adapter sequence is used for scoring.
  2. An alignment with maximum overlap is computed that has the smallest number of mismatches and indels.

Appraise quality with Nanoplot - Long reads just

In case of long reads, we can check sequence quality with Nanoplot (De Coster et al. 2018). It provides basic statistics with nice plots for a fast quality control overview.

hands_on Hands-on: Quality cheque of long reads

  1. Create a new history for this part and requite it a proper proper name

  2. Import the PacBio HiFi reads m64011_190830_220126.Q20.subsample.fastq.gz from Zenodo

                      https://zenodo.org/api/files/ff9aa6e3-3d69-451f-9798-7ea69b475989/m64011_190830_220126.Q20.subsample.fastq.gz                                  
  3. Nanoplot Tool: toolshed.g2.bx.psu.edu/repos/iuc/nanoplot/nanoplot/ane.28.ii+galaxyi with the following parameters
    • param-files "files": m64011_190830_220126.Q20.subsample.fastq.gz
    • "Options for customizing the plots created"
      • param-select "Specify the bivariate format of the plots.": dot, kde
      • param-select "Evidence the N50 mark in the read length histogram.": Yep
  4. Inspect the generated HTML file

question Questions

What is the hateful Qscore ?

solution Solution

The Qscore is around Q32. In case of PacBio CLR and Nanopore, it's around Q12 and shut to Q31 for Illumina (NovaSeq 6000).

Plot of Qscore between Illumina, PacBio and Nanopore.
Figure 16: Comparison of Qscore between Illumina, PacBio and Nanopore

Definition: Qscores is the average per-base fault probability, expressed on the log (Phred) calibration

What is the median, mean and N50?

solution Solution

The median, the hateful read length and the N50 as well are shut to xviii,000bp. For PacBio HiFi reads, the majority of the reads are by and large near this value as the library preparation includes a size selection pace. For other technologies like PacBio CLR and Nanopore, it is larger and mostly depends on the quality of your DNA extraction.

Histogram of read lengths

This plot shows the distribution of fragment sizes in the file that was analyzed. Unlike most of Illumina runs, long reads have a variable length and this will prove the relative amounts of each different size of sequence fragment. In this case, the distribution of read length is centered nigh 15kbp just the results can be very different depending of your experiment.

Histogram of read lengths.
Figure 17: Histogram of read length

Read lengths vs Average read quality plot using dots

This plot shows the distribution of fragment sizes according to the Qscore in the file which was analysed. In general, there is no link betwixt read length and read quality but this representation allows to visualize both information into a single plot and detect possible aberrations. In runs with a lot of short reads the shorter reads are sometimes of lower quality than the rest.

Read lengths vs Average read quality plot using dots.
Figure 18: Histogram of read length

question Questions

Looking at "Read lengths vs Boilerplate read quality plot using dots plot". Did yous detect something unusual with the Qscore? Can you lot explicate it?

solution Solution

There is no reads under Q20. The qualification for HiFi reads is:

  • A minimal number of three subreads
  • A read Qscore >=20
PacBio HiFi sequencing.
Effigy 19: PacBio HiFi sequencing

Appraise quality with PycoQC - Nanopore simply

PycoQC (Leger and Leonardi 2019) is a data visualisation and quality control tool for nanopore information. In contrast to FastQC/Nanoplot it needs a specific sequencing_summary.txt file generated past Oxford nanopore basecallers such as Guppy or the older albacore basecaller.

I of the strengths of PycoQC is that it is interactive and highly customizable, e.g., plots can be cropped, yous can zoom in and out, sub-select areas and export figures.

hands_on Hands-on: Quality cheque of Nanopore reads

  1. Create a new history for this part and give it a proper noun

  2. Import the nanopore reads nanopore_basecalled-guppy.fastq.gz and sequencing_summary.txt from Zenodo

                      https://zenodo.org/api/files/ff9aa6e3-3d69-451f-9798-7ea69b475989/nanopore_basecalled-guppy.fastq.gz https://zenodo.org/api/files/ff9aa6e3-3d69-451f-9798-7ea69b475989/sequencing_summary.txt                                  
  3. PycoQC Tool: toolshed.g2.bx.psu.edu/repos/iuc/pycoqc/pycoqc/2.v.2+galaxy0 with the following parameters

    • param-files "A sequencing_summary file ": sequencing_summary.txt
  4. Audit the webpage output from PycoQC

question Questions

How many reads practise y'all have in total?

solution Solution

~270k reads in full (see the Basecall summary table, "All reads") For most of basecalling profiles, Guppy will assign reads as "Pass" if the read Qscore is at least equal to 7.

What is the median, minimum and maximum read length, what is the N50?

solution Solution

The median read length and the N50 can exist found for all every bit well every bit for all passed reads, i.e., reads that passed Guppy quality settings (Qscore >= 7), in the basecall summary table. For the minimum (195bp) and maximum (256kbp) read lengths, it tin can be found with the read lengths plot.

Basecalled reads length

As for FastQC and Nanoplot, this plot shows the distribution of fragment sizes in the file that was analyzed. Equally for PacBio CLR/HiFi, long reads have a variable length and this volition show the relative amounts of each unlike size of sequence fragment. In this example, the distribution of read length is quite dispersed with a minimum read length for the passed reads effectually 200bp and a maximum length ~150,000bp.

Basecalled reads length.
Figure 20: Basecalled reads length

Basecalled reads PHRED quality

This plot shows the distribution of the Qscores (Q) for each read. This score aims to requite a global quality score for each read. The exact definition of Qscores is: the boilerplate per-base of operations error probability, expressed on the log (Phred) calibration. In instance of Nanopore data, the distribution is generally centered around 10 or 12. For old runs, the distribution can exist lower, as basecalling models are less precise than recent models.

Basecalled reads PHRED quality.
Figure 21: Basecalled reads PHRED quality

Basecalled reads length vs reads PHRED quality

question Questions

What do the mean quality and the quality distribution of the run look similar?

solution Solution

The majority of the reads have a Qscore between 8 and 11 which is standard for Nanopore data. Beware that for the aforementioned data, the basecaller used (Albacor, Guppy, Bonito), the model (fast, hac, sup) and the tool version can give unlike results.

Equally for NanoPlot, this representation give a 2D visualisation of read Qscore according to the length.

Basecalled reads length vs reads PHRED quality.
Figure 22: Basecalled reads length vs reads PHRED quality

Output over experiment time

This representation gives data about sequenced reads over the time for a single run:

  • Each motion picture indicates a new loading of the flow cell (3 + the first load).
  • The contribution in full reads for each "refuel".
  • The product of reads is decreasing over time:
    • About of the material (Dna/RNA) is sequenced
    • Saturation of pores
    • Material/pores degradation
    • …

In this example, the contribution of each refueling is very low, and it can exist considered as a bad run. The "Cummulative" plot area (light blue) indicates that fifty% of all reads and almost fifty% of all bases were produced in the first 5h of the 25h experiment. Although it is normal that yield decreases over fourth dimension a decrease similar this is not a practiced sign.

Output over experiment time.
Figure 23: Output over experiment time

details Other "Output over experiment time" profile

In this example, the data production over the time only slightly decreased over the 12h with a continuous increasing of cumulative data. This absence of a decreasing bend at the terminate of the run point that at that place is withal biological material on the flow cell. The run was ended earlier all was sequenced. Information technology's an fantabulous run, even can be considered as exceptional.

Output over experiment time good profile.

Read length over experiment time

question Questions

Did the read length change over fourth dimension? What could the reason exist?

solution Solution

In the current case the read length increases over the time of the sequencing run. 1 caption is that the adapter density is college for lots of short fragments and therefore the chance of a shorter fragment to attach to a pore is higher. Also, shorter molecules may move faster over the chip. Over time, however, the shorter fragments are becoming rarer and thus more long fragments attach to pores and are sequenced.

The read length over experiment time should be stable. Information technology tin slightly increment over the time as short fragments tend to be over-sequenced at the outset and are less present over the fourth dimension.

Read length over experiment time.
Figure 24: Read length over experiment time

Channel activity over fourth dimension

It gives an overview of available pores, pore usage during the experiment, inactive pores and shows if the loading of the menstruation cell is good (well-nigh all pores are used). In this example, the vast majority of channels/pores are inactive (white) throughout the sequencing run, and so the run can be considered as bad.

You would promise for a plot that it is dark well-nigh the X-axis, and with higher Y-values (increasing time) doesn't get besides low-cal/white. Depending if yous chose "Reads" or "Bases" on the left the colour indicates either number of bases or reads per fourth dimension interval

Channel activity over time.
Figure 25: Aqueduct activeness over time

details Other "Channel action over fourth dimension" contour

In this example, almost all pores are active all forth the run (yellow/ruddy profile) which indicate an excellent run.

Channel activity over time good profile.

Determination

In this tutorial we checked the quality of FASTQ files to ensure that their data looks good before inferring any further information. This pace is the usual first step for analyses such as RNA-Seq, Scrap-Seq, or any other OMIC analysis relying on NGS information. Quality control steps are similar for any type of sequencing data:

  • Quality assessment with tools similar:
    • Short Reads : FASTQE Tool: toolshed.g2.bx.psu.edu/repos/iuc/fastqe/fastqe/0.2.6+galaxy2
    • Short+Long: FASTQC Tool: toolshed.g2.bx.psu.edu/repos/devteam/fastqc/fastqc/0.73+galaxy0
    • Long Reads : Nanoplot Tool: toolshed.g2.bx.psu.edu/repos/iuc/nanoplot/nanoplot/1.28.two+galaxy1
    • Nanopore merely: PycoQC Tool: toolshed.g2.bx.psu.edu/repos/iuc/pycoqc/pycoqc/2.5.2+milky way0
  • Trimming and filtering for short reads with a tool like Cutadapt tool

Key points

  • Perform quality command on every dataset before running whatsoever other bioinformatics assay

  • Assess the quality metrics and better quality if necessary

  • Bank check the touch of the quality control

  • Different tools are available to provide additional quality metrics

  • For paired-end reads analyze the forrad and opposite reads together

Frequently Asked Questions

Take questions about this tutorial? Check out the tutorial FAQ page or the FAQ folio for the Sequence analysis topic to meet if your question is listed there. If not, please ask your question on the GTN Gitter Aqueduct or the Milky way Help Forum

Useful literature

Further data, including links to documentation and original publications, regarding the tools, analysis techniques and the interpretation of results described in this tutorial can be institute here.

References

  1. Marcel, M., 2011 Cutadapt removes adapter sequences from high-throughput sequencing reads. EMBnet.periodical 17: 10–12. http://journal.embnet.org/index.php/embnetjournal/article/view/200
  2. Ewels, P., Yard. Magnusson, S. Lundin, and M. Käller, 2016 MultiQC: summarize analysis results for multiple tools and samples in a single report. Bioinformatics 32: 3047–3048. https://academic.oup.com/bioinformatics/article/32/nineteen/3047/2196507
  3. De Coster, W., Southward. D'Hert, D. T. Schultz, M. Cruts, and C. Van Broeckhoven, 2018 NanoPack: visualizing and processing long-read sequencing data. Bioinformatics 34: 2666–2669. 10.1093/bioinformatics/bty149
  4. Leger, A., and T. Leonardi, 2019 pycoQC, interactive quality control for Oxford Nanopore Sequencing . Journal of Open up Source Software 4: 1236. 10.21105/joss.01236
  5. Jacques, R. Chiliad. S., Due west. Grand. Maza, South. D. Robertson, A. Lonsdale, C. S. Murray et al., 2021 A Fun Introductory Command Line Lesson: Next Generation Sequencing Quality Analysis with Emoji! CourseSource viii: x.24918/cs.2021.17

Feedback

Did you utilize this textile equally an teacher? Experience gratis to requite the states feedback on how it went.
Did you use this material as a learner or student? Click the class below to leave feedback.

Click here to load Google feedback frame

Citing this Tutorial

  1. Bérénice Batut, Maria Doyle, Alexandre Cormier, Anthony Bretaudeau, Laura Leroi, Erwan Corre, Stéphanie Robin, Erasmus+ Programme, 2021 Quality Control (Galaxy Training Materials). https://preparation.galaxyproject.org/training-cloth/topics/sequence-analysis/tutorials/quality-control/tutorial.html Online; accessed TODAY
  2. Batut et al., 2018 Customs-Driven Information Assay Preparation for Biology Cell Systems x.1016/j.cels.2018.05.012

details BibTeX

              @misc{sequence-analysis-quality-command, author = "Bérénice Batut and Maria Doyle and Alexandre Cormier and Anthony Bretaudeau and Laura Leroi and Erwan Corre and Stéphanie Robin and Erasmus+ Programme", title = "Quality Control (Milky way Grooming Materials)", year = "2021", month = "12", day = "14" url = "\url{https://training.galaxyproject.org/preparation-material/topics/sequence-analysis/tutorials/quality-command/tutorial.html}", note = "[Online; accessed TODAY]" } @article{Batut_2018,     doi = {ten.1016/j.cels.2018.05.012},     url = {https://doi.org/10.1016%2Fj.cels.2018.05.012},     yr = 2018,     month = {jun},     publisher = {Elsevier {BV}},     volume = {6},     number = {half dozen},     pages = {752--758.e1},     author = {B{\'{due east}}r{\'{e}}prissy Batut and Saskia Hiltemann and Andrea Bagnacani and Dannon Baker and Vivek Bhardwaj and Clemens Blank and Anthony Bretaudeau and Loraine Brillet-Gu{\'{eastward}}guen and Martin {\five{C}}ech and John Chilton and Dave Clements and Olivia Doppelt-Azeroual and Anika Erxleben and Mallory Ann Freeberg and Simon Gladman and Youri Hoogstrate and Hans-Rudolf Hotz and Torsten Houwaart and Pratik Jagtap and Delphine Larivi{\`{e}}re and Gildas Le Corguill{\'{e}} and Thomas Manke and Fabien Mareuil and Fidel Ram{\'{\i}}rez and Devon Ryan and Florian Christoph Sigloch and Nicola Soranzo and Joachim Wolff and Pavankumar Videm and Markus Wolfien and Aisanjiang Wubuli and Dilmurat Yusuf and James Taylor and Rolf Backofen and Anton Nekrutenko and Björn Grüning},     championship = {Community-Driven Data Analysis Training for Biological science},     journal = {Prison cell Systems} }            

Congratulations on successfully completing this tutorial!

bakerpoldned97.blogspot.com

Source: https://galaxyproject.github.io/training-material/topics/sequence-analysis/tutorials/quality-control/tutorial.html

0 Response to "Read 2 Quality Worse Than Read 1 Sequencing"

Postar um comentário

Iklan Atas Artikel

Iklan Tengah Artikel 1

Iklan Tengah Artikel 2

Iklan Bawah Artikel